Each isolate was tested in duplicate. No Template Controls (NTCs) and previously characterized positive controls were used for each primer set as well. Mutation detection in the gyrA and pbp5 genes All ciprofloxacin- and ampicillin-resistant and intermediate-resistant isolates were screened

for gene mutations. The gyrA and pbp5 genes were amplified and sequenced. Primers used were: 5′CGGGATGAACGAATTGGGTGTGA3′and 5′ AATTTTACTCATACGTGCTTCGG 3′ (gyrA forward and reverse respectively); and 5′ CGGGATCTCACAAGAAGAT 3′and 5′ TTATTGATAATTTTGGTT 3′ (pbp5 forward and reverse respectively) [34–36]. Sequencing reactions were prepared as for the SNP selleck screening library validation step described above. Sequence data was analysed using Chromas (version 1.43, Technelysium, Tewantin, Australia) and Vector NTI (version 11, Invitrogen, Australia) software programs. Results and Discussion The poor microbiological quality of recreational waters is a global issue [37, 38]. There is a great need to rapidly and APO866 order accurately determine human faecal contamination of recreational

waters. We applied a SNP genotyping method to water samples collected from the Coomera River, South East Queensland, Australia, to determine the distribution and diversity of E. faecalis and E. faecium strains and establish the antibiotic profiles associated with different SNP profiles. Total enterococccal counts in the Coomera River, over a two year period Enumeration of enterococcal strains was performed at each of the six sampling sites along the Coomera River, and these counts were compared to the single-sample advisory limit specified by the US Environmental Protection Agency (USEPA) and the Australian NHMRC Guidelines

for water quality assessment. Nintedanib Previous studies have found that the concentration of faecal indicator bacteria in surface waters is influenced by storm water runoff and can increase dramatically during rainfall events in comparison to baseline conditions [39–42]. Similarly, we found an increase in the number of enterococci at three of the sampling sites after rainfall events (August 2008 and March 2009). There was a substantial increase in enterococcal colony counts at Jabiru Island (C4), Paradise Point (C5) and Coombabah (C6) after rainfall events. These findings were confirmed by the Mann-Whitney test which showed that enterococcal counts after rainfall events differ significantly between the different locations; C4-C5 (p = 0.004) compared to C1-C3 (p = 0.029), (additional file 1). These counts were well above the USEPA recommended level (61 cfu/100 ml). According to the Australian NHMRC Guidelines these locations are categorised into the microbial water quality assessment category B (41-200 cfu/100 ml), except for Jabiru Island (March 2009), which was category C (201-500 cfu/100 ml).